Association of KCNJ11 gene (rs5219) polymorphism with HOMA-IR and HOMA B values in type 2 diabetes mellitus in India: A case-control study

INTRODUCTION

The multifactorial illness known as type 2 diabetes mellitus (T2DM) is characterized by either insufficient insulin secretion or insufficient insulin activity, which hinders the body’s ability to maintain glucose homeostasis. Worldwide, the incidence of T2DM is on the rise.¹ With over 250 million cases worldwide, T2DM is more widespread than it was a few decades ago.² T2DM etiology has been linked to interactions between many genetic determinants and environmental variables. A deeper knowledge of the genetic architecture of type 2 diabetes has been made possible by the identification of at least 75 distinct genetic loci for the disease over the course of the last ten years thanks to advancements in genetic association studies.³ Some genes that are particularly good indicators of T2DM susceptibility include those that encode proteins essential for pancreatic beta cell functions, such as those linked to insulin secretion. The route leading to the release of insulin begins with glucose inhibiting ATP-sensitive potassium (KATP) channels. This is followed by the β-cell membrane depolarizing, an increase in calcium ion inflow, and intracellular calcium stimulating the exocytosis of insulin-containing granules. This KATP channel is an inwardly-rectifying K+ channel composed of two structurally unrelated subunits of an octamer protein complex with four pores. Potassium inwardly-rectifying channel, subfamily J, member11 (KCNJ11) subunits are linked to four high-affinity sulfonylurea receptor (SUR1, ABCC8) subunits.⁴ Recent years have seen a great deal of attention in KCNJ11 as a potential gene for Type 2 diabetes. The NCBI (National Centre for Biotechnology Information) database for humans has 180 single nucleotide polymorphisms (SNPs) related to this gene. It spans two kilobases, is located at 11p15.1, contains one exon that encodes 390 amino acids, and controls the amount of insulin secreted by pancreatic beta cells in response to glucose.⁵ It has been demonstrated that the reduction in KATP sensitivity caused by the substitution of the amino acid lysine (K) for glutamate (E) in codon 23 of the KCNJ11 gene causes the channel to open for a longer period of time, hence reducing insulin production.^6,7 As a result, several researches found a strong correlation between the E23K variation of KCNJ11 and T2DM susceptibility.^8–10

Previous research reports have indicated that Asians seem to have a fairly common KCNJ11 polymorphism (rs5219). Small and medium-sized researches were conducted in this community, and conflicting findings about the link between this variation and type 2 diabetes were found.^11–16 The influence of rs5219 on susceptibility to type 2 diabetes is not fully explored due to the published research’s limitations in terms of sample size and ethnic diversity, and their small sample size may make it impossible to draw meaningful conclusions. The conclusive determination of the connection between KCNJ11 polymorphism (rs5219) and T2DM in South Asian populations requires the completion of sufficient thorough meta-analyses and genome-wide association studies (GWAS).

The current study was conducted to assess the relationship between KCNJ11(rs5219) gene polymorphism and associations between this genetic variation and diabetes susceptibility in T2DM in India, as the genetic background for this genetic variant has not been investigated much for T2DM in this population.

MATERIAL AND METHODS

Genotyping

DNA Extraction Kit (Krishgen) was used to extract genomic DNA from nucleated blood cells. The extracted DNA was amplified using polymerase chain reaction (PCR) by utilizing the following primers- forward=5’‐GACTCTGCAGTGAGGCCCTA‐3’ reverse=5’ACGTTGCAGTTGCCTTTCTT‐3’.²⁰ The Indian company “Eurofins Scientific” created the primers. The amplification of DNA was done using a PCR reaction mixture with the help of a thermal cycler (Himedia Eco-96). This 25 µL PCR reaction mixture contained 3 µl of genomic DNA, 0.25 µl of each primer, 6.5 µl of nuclease-free water, and 10 µL of Dream Taq green PCR Master-mix manufactured by Thermo fisher-scientifc (Catalog no. K1081), which had 3.2 µM Taq DNA polymerase, 3.2 µM 2X bufer, 32 µM MgCl2, and 3.2 µM of each dNTPs. The following PCR conditions were used: initial denaturation at 95°C for 5 min, followed by 30 cycles of denaturation at 95°C for 30 sec; annealing at 57°C for 30 sec, then extension at 72°C for 30 sec. The final extension step was at 72°C for 5 min and kept for temporary storage at 4°C. The PCR amplification was confirmed by gel electrophoresis (2% agarose gel and Ethidium bromide staining). The amplified PCR product of 210 bp in 1 μl quantity was incubated with BanII (Catlog no. R0119S) (New England, Biolabs, England) restriction enzyme²⁰ at 37°C for 60 min in 50 μl reaction mixture that contained 10 × NE buffer. The digested PCR products were then resolved on 2% agarose gel electrophoresis for the E23K genotypes. The Homozygous KK Genotype was digested into two fragments of 178 bp and 28 bp. Homozygous EE Genotype was cut into three fragments of 150 bp, 32 bp, and 28 bp in heterozygous subjects. With the EK genotype, the PCR product breaks into four fragments of 178 bp, 150 bp, 32 bp and 28 bp. On 2% agarose gel electrophoresis, 32 bp and 28 bp being very small are not visible on gel as depicted in Figure. 1.

Close

Figure 1:

KCNJ11 gene polymerase chain reaction (PCR) products were broken down using the BanII restriction enzyme. At 150 bp, homozygous EE has a single band. There are two bands at 178 bp and 150 bp in heterozygous EK. The homozygous KK sample was electrophoresed on a 2% agarose gel, revealing a single band at 170 bp. Lane 1 displays the homozygote KK genotype, lanes 2, 4, and 7 the heterozygote EK genotype, and lanes 3, 4, and 6 the homozygote EE genotype. M is a DNA ladder (50 bp ladder). Due to their extremely small size, the bands corresponding to sizes 32 and 28 bp are invisible in the gel.

Export to PPT

Results

This study confirmed the association between KCNJ11 (rs5219) gene polymorphism in HOMA-IR and HOMA-β values in 110 participants. Of these, 55 patients were diagnosed with T2DM. As per ADA criteria, mean age was 46 ± 10.24 years where 40% were males and 60% were females. The control group comprised 55 age- and gender-matched healthy individuals with mean age of 42 ± 10.7 years, where 47.27% were males and 52.73% were females. The demographic profile along with the clinical and laboratory parameters of the study population is depicted in Table 1. The difference in age and gender between cases and controls was not statistically significant. However, weight and body mass index were significantly higher in cases than controls (p<0.001). Subgroup analysis of biochemical markers between T2DM and control group in this study showed statistically significant difference in HbA1C (p<0.001), fasting blood glucose (p<0.01), and postprandial blood glucose (p<0.001) with values greater than in the control group.

Table 2 depicts the serum insulin levels, HOMA-IR, and HOMA-β values in T2DM patients and controls. Serum insulin levels were found to be significantly lower in cases than in the control group (9.95±3.12 vs 15.1±4.6 µIU/mL, p<0.0028). Similarly, HOMA-IR and HOMA-β and values showed a significant decrease in cases than controls (2.6±0.9 vs 3.3855±1.1 µIU/mL, p <0.03) and (2.6±0.9 vs 3.3855±1.1 µIU/mL, p <0.03), respectively.

Table 3 displays the distribution of genotypes and alleles for the KCNJ11 rs 5219 (E23K) polymorphism. In the T2DM group, the frequencies of the EE, EK, and KK genotypes were 25%, 18%, and 12%, respectively, compared to 40%, 10%, and 5% in the control group. The homozygous KK genotype of KCNJ11 rs 5912 SNP has a 3.8-fold greater risk of type 2 diabetes in the Indian population, according to logistic regression analysis (odds ratio OR = 3.84, 95% Cl 1.21–12.21, p = 0.01). In the Indian population, the heterozygous EK genotype likewise demonstrated a 2.8-fold elevated risk of type 2 diabetes (odds ratio OR = 2.88, 95% Cl 1.15–07.22, p = 0.02). Individuals with type 2 diabetes showed a noticeably higher prevalence of the K allele than in controls (OR 9.9, 95% Cl 0.036–0.36. p = 0.001).

The inter-genotypic variation of the HOMA-β in T2DM and controls is shown in Table 4. Our results showed that HOMA-β in KK, EK, and EE genotypes of the patients with T2DM was 59.9±27.83, 76.8±33.23, 127.9±44.60%, respectively. The inter-genotypic difference in HOMA-β values was statistically significant in T2DM patients.

DISCUSSION

One of the most common noninfectious diseases in the world, type 2 diabetes has been getting more and more common over the past few decades. Susceptibility to T2DM is influenced by both environmental susceptibility and genetic background. The illness has been linked to several genes.²¹ The KCNJ11 protein encodes a crucial role in the production of insulin from pancreatic β-cells, suggesting that it may be a susceptibility gene for type 2 diabetes. However, E23K polymorphism in KCNJ11, plays an important role in suppression of insulin secretion.^22,23 The amino acid substitution, replacing lysine (AAG) with glutamic acid (GAG) resulting due to E23K polymorphism leads to altered physiochemical properties wherein the negative charge replace the positive charge. This prolongs the opening of KATP channel and decreases its sensitivity to ATP and suppresses insulin production.^24,25

When stratified by ethnicity, a meta-analysis study by Takeuchi et al.²⁶ revealed a significant connection between the E23K (rs5219) polymorphism and T2D risk among East Asians and Caucasians; no significant associations were detected among South Asians and other ethnic populations. Given the variability in associations and scarcity of literature from the Indian subcontinent, we tried to investigate the correlation of this SNP with HOMA-β and HOMA-IR in the Indian population for T2DM patients and controls.

Our findings support previous research on the Russian, Syrian, and Iranian populations, which indicated that patients had a higher frequency of the KK genotype than controls.^27–29 In the study done by Li YY in 2013,²⁹ it was found that E23K contributed to T2DM susceptibility.

In addition, our data showed that KK genotype carriers were significantly more likely than controls to develop type 2 diabetes. Furthermore, HOMA-β was used as a model to analyze pancreatic β-cell activity and evaluate the insulin secretion of the study participants. The results showed that there was a statistically significant difference in HOMA-β values between the KK, EK, and EE genotype groups. These findings are consistent with the research conducted by Sunita et al.³⁰ Our study’s K allele prevalence of 38% is comparable to that of research conducted in Asian and Caucasian populations.^31–34

A range of models were used to assess the relationship between the KCNJ11 rs5219 polymorphism and the risk of type 2 diabetes. The results showed that the dominant genetic model (EE vs. KK + EK) was linked to a sevenfold increased risk of developing diabetes compared to controls, with an OR of 7.37 (95% CI 0.06 to 0.47, P = 0.006). Wang et al.’s meta-analysis study³⁴ indicates that the KK genotype is consequently linked to an eightfold increase in the risk of T2DM. In a similar vein, other studies have also been published^30,35–38 showing a link between the KK genotype and an increased risk of diabetes.

The KK genotype’s HOMA-β values (59.9±27.83) in our study were found to be lower than those of the EK (76.8±33.23) and EE (127.9±44.60) genotypes. A One-Way ANOVA analysis revealed a significant difference (P<0.0001) in the HOMA-β value between the EE, EK, and KK genotypes. The effects of a single genetic component on the development of T2DM varies throughout individuals due to differences in environmental circumstances. T2DM is recognized as a complex condition caused by the interaction of several hereditary and environmental factors. In India, a large number of people experience varying degrees of stress and generally have poor eating habits. This might account for the high-risk value (nine times) in our study in a sample of the Indian population in comparison to other groups, since these potent environmental factors may magnify the influence of the genetic component in the risk allele carriers.

CONCLUSION

This study showed an association between rs5219 polymorphism of the KCNJ11 gene with susceptibility to develop T2DM in the Indian population. Also, K allele is more likely to be present in individuals with T2DM than the control group. However, additional studies with a larger sample size will be required to confirm this marker in the Indian population.

The limitation of the present study is that it did not consider the interactions between the gene and its protein. The study was conducted only on a single SNP of the KCNJ11(rs5219) gene. Hence, further studies on other SNPs of KCNJ11 should be carried out to prove the significant association between genetic markers and biochemical markers in T2DM. Moreover, a large cohort study is required to validate the expression of these genes in diverse populations in a country like India.